Double-strand Break Repair Through Homologous Recombination in Autosomal-Recessive BCL10 Deficiency.

Three members of the caspase recruitment domain (CARD) family of adaptor proteins (CARD9, CARD10, and CARD11) are known to form heterotrimers with B-cell lymphoma 10 (BCL10) and mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1), resulting in the CARD-BCL10-MALT1 (CBM) complex. In humans and mice, the CBM complex mediates nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and mitogen-activated protein kinase activation in a cell-type–specific and nonredundant manner, after the stimulation of various immune receptors. The NF-κB transcription factor plays a critical role in innate and adaptive immune regulation, cell memory, cell survival/apoptosis, and cell cycle progression. Different cell types contain different members of the CARD family: myeloid cells contain CARD9, epithelial cells contain CARD10, and lymphocytes contain CARD11. In lymphocytes, the CBM complex acts downstream from the T-cell receptor and B-cell receptor, controlling lymphocyte activation and adaptive immunity. The CBM complex has also been implicated in B-cell–activating factor receptor and Toll-like receptor 4 (TLR4) signaling in B cells and in the signaling of several natural killer receptors, such as NK1.1, Ly49H, NKG2D, and Ly49D. In myeloid cells from mice, the CBM complex is involved in innate immune responses, in which it acts downstream from C-type lectin receptors, such as Dectin-1, Dectin-2, and Mincle, and other receptors, such as FcγR and TLRs. The CBM complex is also involved in downstream signaling from TLR4 and G protein–coupled receptor signaling in epithelial cells.1Gehring T. Seeholzer T. Krappmann D. BCL10—bridging CARDs to immune activation.Front Immunol. 2018; 9: 1539Crossref PubMed Scopus (33) Google Scholar Inherited defects in the 3 components of the CBM complex, including the 2 adaptor proteins CARD9 and CARD11 and the 2 core components BCL10 and MALT1, have been reported in humans. Biallelic loss-of-function mutations underlie several different immunologic and clinical phenotypes, which can be assigned to 2 distinct categories: CARD9 deficiency, which is associated with isolated invasive fungal infections of unclear cellular basis,2Perez de Diego R. Sanchez-Ramon S. Lopez-Collazo E. Martinez-Barricarte R. Cubillos-Zapata C. Ferreira Cerdan A. et al.Genetic errors of the human caspase recruitment domain-B-cell lymphoma 10-mucosa-associated lymphoid tissue lymphoma-translocation gene 1 (CBM) complex: molecular, immunologic, and clinical heterogeneity.J Allergy Clin Immunol. 2015; 136: 1139-1149Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar and CARD11, MALT1, and BCL10 deficiencies, which are associated with a broad range of clinical manifestations, including those characteristic of T-cell and B-cell defects.2Perez de Diego R. Sanchez-Ramon S. Lopez-Collazo E. Martinez-Barricarte R. Cubillos-Zapata C. Ferreira Cerdan A. et al.Genetic errors of the human caspase recruitment domain-B-cell lymphoma 10-mucosa-associated lymphoid tissue lymphoma-translocation gene 1 (CBM) complex: molecular, immunologic, and clinical heterogeneity.J Allergy Clin Immunol. 2015; 136: 1139-1149Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar The only patient reported so far with BCL10 deficiency was an Amerindian boy who was born to consanguineous parents and who died because of combined immunodeficiency.3Torres J.M. Martinez-Barricarte R. Garcia-Gomez S. Mazariegos M.S. Itan Y. Boisson B. et al.Inherited BCL10 deficiency impairs hematopoietic and nonhematopoietic immunity.J Clin Invest. 2014; 124: 5239-5248Crossref PubMed Scopus (83) Google Scholar The patient had autosomal-recessive complete BCL10 deficiency, resulting in an absence of wild-type (WT) mRNA and protein. The patient experienced multiple infections from the age of 6 months, including otitis, encephalitis of unknown etiology, oral candidiasis, diaper dermatitis with Candida albicans superinfection, and respiratory infections. At the gastrointestinal level, the patient experienced active chronic colitis, prolonged diarrhea due to Campylobacter jejuni infection, acute gastroenteritis due to adenovirus, and diarrhea caused by Clostridium difficile. T-cell and B-cell counts revealed a profound deficit in memory T and B cells, a normal response in myeloid cells, and a strong effect on NF-κB–mediated fibroblast functions.3Torres J.M. Martinez-Barricarte R. Garcia-Gomez S. Mazariegos M.S. Itan Y. Boisson B. et al.Inherited BCL10 deficiency impairs hematopoietic and nonhematopoietic immunity.J Clin Invest. 2014; 124: 5239-5248Crossref PubMed Scopus (83) Google Scholar Recent studies have highlighted the role of the CBM complex in DNA repair.4Ismail I.H. Dronyk A. Hu X. Hendzel M.J. Shaw A.R. BCL10 is recruited to sites of DNA damage to facilitate DNA double-strand break repair.Cell Cycle. 2016; 15: 84-94Crossref PubMed Scopus (12) Google Scholar, 5Zhao H. Zhu M. Dou G. Zhu B. Li J. Liao J. et al.BCL10 regulates RNF8/RNF168-mediated ubiquitination in the DNA damage response.Cell Cycle. 2014; 13: 1777-1787Crossref PubMed Scopus (12) Google Scholar Studies conducted with human cell lines have found that BCL10 can translocate to the nucleus and have shown that BCL10 functions as part of the DNA damage response. BCL10 facilitates the rapid recruitment of replication protein A (RPA), breast cancer gene 1 (BRCA1), and RAD51 to DNA damage sites, specifically mediating DNA double-strand break (DSB) repair via homologous recombination (HR).4Ismail I.H. Dronyk A. Hu X. Hendzel M.J. Shaw A.R. BCL10 is recruited to sites of DNA damage to facilitate DNA double-strand break repair.Cell Cycle. 2016; 15: 84-94Crossref PubMed Scopus (12) Google Scholar, 5Zhao H. Zhu M. Dou G. Zhu B. Li J. Liao J. et al.BCL10 regulates RNF8/RNF168-mediated ubiquitination in the DNA damage response.Cell Cycle. 2014; 13: 1777-1787Crossref PubMed Scopus (12) Google Scholar To analyze the role of BCL10 in both DNA repair pathways, we treated BCL10−/− cells immortalized by Simian Virus 40 (SV40) fibroblasts with hydroxyurea (HU) and hydrogen peroxide (H2O2) or γ-irradiated (3 Gy of ionizing radiation) to induce DSBs. BCL10−/− cells came from a single patient previously described.3Torres J.M. Martinez-Barricarte R. Garcia-Gomez S. Mazariegos M.S. Itan Y. Boisson B. et al.Inherited BCL10 deficiency impairs hematopoietic and nonhematopoietic immunity.J Clin Invest. 2014; 124: 5239-5248Crossref PubMed Scopus (83) Google Scholar We then evaluated the γ-H2AX foci at various times after the treatment. The results showed that most of the DSBs induced with genotoxic agents such as HU and H2O2 could be efficiently repaired in the control cells but not in the BCL10−/− patient's cells, which suggests that BCL10 plays an important role in DSB repair via HR. However, the γ-irradiation–induced DSBs (mainly repaired by nonhomologous end joining pathway) were repaired efficiently in the BCL10−/− cells and control cells, which indicates that BCL10 has a nonessential role in nonhomologous end joining repair pathway (Fig 1). These results agree with those of previous studies on human cell lines that have shown the role of BCL10 in the HR repair pathway. We also studied the complementation of the phenotype in terms of HR repair after treatment with HU and H2O2. We transfected the BCL10−/− SV40 fibroblasts with WT BCL10 and we analyzed the number of γ-H2AX foci/cells after the treatment. The results showed that the DSBs were efficiently repaired by the HR pathway in BCL10−/− cells transfected with WT BCL10 (Fig 2).Fig 2Complementation studies. A, Immunodetection of γ-H2AX foci at the indicated time points after hydroxyurea treatment. B, Quantification of the mean number of induced γ-H2AX foci per cells, in SV40 fibroblasts from BCL10−/− patient (BCL10−/−), BCL10−/− transfected with WT BCL10 plasmid (BCL10−/− + WT), and healthy donor (C2). For each condition 30 nuclei were analyzed. Mean values of nuclei analyzed ± SD were calculated from 3 independent experiments. BCL10−/− and C2 data are replicated from Fig 1. Nonsignificant (ns), P < .05 (*), .001 (***), .0001 (****) for different times in BCL10−/− or between BCL10−/− and BCL10−/− + WT at same times. Differences between times for C2 was statistically significant with at least P < .05 (data not shown). DAPI, 4′-6-Diamidino-2-phenylindole, dihydrochloride.View Large Image Figure ViewerDownload Hi-res image Download (PPT) DNA repair pathways play a key role in protecting the genome against instability. The HR pathway plays a crucial role in preventing the development of cancer cells and could be used as a therapeutic target. Because of its role in maintaining genome integrity, the HR pathway is often considered the last resort for preventing tumorigenesis. Numerous HR gene mutations have been associated with cancer (eg, BRCA1 and BRCA2 in breast and ovarian cancer6Wooster R. Bignell G. Lancaster J. Swift S. Seal S. Mangion J. et al.Identification of the breast cancer susceptibility gene BRCA2.Nature. 1995; 378: 789-792Crossref PubMed Scopus (2949) Google Scholar and RAD54 in colon cancer7Hiramoto T. Nakanishi T. Sumiyoshi T. Fukuda T. Matsuura S. Tauchi H. et al.Mutations of a novel human RAD54 homologue, RAD54B, in primary cancer.Oncogene. 1999; 18: 3422-3426Crossref PubMed Scopus (116) Google Scholar). Genes implicated in other DNA repair pathways have also been implicated in cancer, such as the Mre11-Rad50-Nbs1 (MRN) complex in melanoma, ovarian, colorectal, and head and neck cancer; RECQL4 in skin carcinomas8Mohaghegh P. Hickson I.D. DNA helicase deficiencies associated with cancer predisposition and premature ageing disorders.Hum Mol Genet. 2001; 10: 741-746Crossref PubMed Scopus (190) Google Scholar; and other well-characterized helicases. The evidence makes it abundantly clear that defects in the proteins implicated in the HR repair pathway could cause cancer and are common in cancer cells. In our study, the HR pathway did not properly repair the DSBs in the cells from the patient with BCL10 deficiency. Unlike genetic defects associated with DNA repair, BCL10−/− patient did not show increased risk of malignance, but it is worth mentioning that the patient died at a very young age (3 years). Despite the patient's clinical outcome due to the mutation's severity, this study shows that future patients with new loss-of-function BCL10 mutations will have greater susceptibility to developing cancer because the HR repair pathway would be affected. Moreover, BCL10 overproduction has been implicated in MALT lymphoma, and several therapeutic studies have therefore attempted to inhibit CBM complex expression.9Ferch U. Kloo B. Gewies A. Pfander V. Duwel M. Peschel C. et al.Inhibition of MALT1 protease activity is selectively toxic for activated B cell-like diffuse large B cell lymphoma cells.J Exp Med. 2009; 206: 2313-2320Crossref PubMed Scopus (145) Google Scholar Our observations of human BCL10−/− fibroblasts are highly pertinent and should be taken into account when considering treatment options for MALT lymphoma, given that BCL10 inhibition can affect the HR repair pathway and increase a patient's predisposition to malignancies. We thank the members of the Laboratory of Human Genetics of Infectious Diseases for their helpful advice. We also thank the patient and his family for participating in this study. Primary human fibroblasts were obtained from biopsy specimens from BCL10−/− patients or healthy controls and were cultured in Dulbecco modified Eagle medium (Invitrogen, Carlsbad, Calif) supplemented with 10% FCS. They were then transformed with an SV40 vector, as previously describedE1Chapgier A. Wynn R.F. Jouanguy E. Filipe-Santos O. Zhang S. Feinberg J. et al.Human complete Stat-1 deficiency is associated with defective type I and II IFN responses in vitro but immunity to some low virulence viruses in vivo.J Immunol. 2006; 176: 5078-5083Crossref PubMed Scopus (154) Google Scholar to create immortalized fibroblast cell lines: SV40-fibroblasts. The SV40 fibroblasts were cultured in 35-mm cell culture dishes (Thermo Fisher Scientific, Waltham, Mass) at a density of 50,000 cells/mL (100,000 cells per condition). Cells were grown at 37°C, in an atmosphere containing 5% CO2. Treatments used for DNA damaging and immunocytochemistry: SV40 fibroblasts were irradiated with ionizing radiation (137Cs) or treated for 30 minutes with 1 mM H2O2 (Sigma, St Louis, Mo) or overnight with 0.5 Mm HU (Sigma), washed 3 times with PBS 1×, and kept in Dulbecco modified Eagle medium for various repair times (0, 2, 6, and 24 hours) in a humidified incubator with 5% CO2. After the indicated treatments, the slides were washed with PBS, fixed using 4% formaldehyde for 10 minutes at room temperature, and permeabilized with 0.5% Triton X-100 for 5 minutes. Cells were incubated with primary antibody H2AX-P (ab18311; Abcam, Cambridge, Mass) at a 1:400 dilution in PBS 1× 2% BSA for 30 minutes at room temperature. The slides were then washed 3 times with PBS 1× and incubated with Alexa Fluor 488 goat anti–mouse IgG (H+L) secondary antibody (Molecular Probes, Eugene, Ore) for 30 minutes at room temperature in the dark. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole, and slides were mounted for immunofluorescence. Images were acquired with fluorescent microscopy (Zeiss AxioImages.A1, Carl Zeiss, Jena, Germany). In a single experiment, cell counting was performed until at least 30 cells/sample. The full-length WT BCL10 cDNA was amplified from cDNA generated from phytohemagglutinin T-cell blasts from a healthy individual. Regular PCR was performed, using the following primers: forward primer: ATGGAGCCCACCGCACCGTCCCTCACCG and reverse primer: CATTGTCGTGAAACAGTACGTGATCTTAAGGG. The products were TA-cloned into a pcDNA3.1/V5-His plasmid (Invitrogen), according to the manufacturer's protocol. SV40 fibroblasts were transfected with a nucleofection device (Lonza, Walkersville, Md) and an Amaxa cell line nucleofector kit V (Lonza), according to the manufacturer's instructions. The U-023 program was used for fibroblast transfection (1.8 × 106 cells per 2 μg of plasmid). The data were collected from a minimum of 3 experiments and expressed as mean ± SD. The statistical significance was calculated using 1-way ANOVA comparing differences between times or between samples. Differences were determined using Bonferroni post hoc analysis, and differences between samples were statistically significant at P < .05. Statistical analyses were performed using SPSS 23 (Armonk, NY). The experimental protocol was approved by the ethics committee of La Paz University Hospital (Madrid, Spain), and written informed consent was obtained from the patients for participation in this study.